Short communication: Translational efficiency of casein transcripts in Mediterranean river buffalo

نویسندگان
چکیده

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Translational efficiency of casein transcripts in the mammary tissue of lactating ruminants.

Caseins are essentially concentrated in the colloidal fraction of ruminant milks as highly hydrated and mineralized spherical particles, termed casein micelles. They form a group of four peptide chains (alpha(s1), beta, alpha(s2) and kappa), encoded by four structural genes (CSN1S1, CSN2, CSN1S2 and CSN3, respectively) of which the expression is regulated by lactogenic hormones. These phosphopr...

متن کامل

Rapid communication: nucleotide sequence of the river buffalo beta-casein cDNA.

Name of the Sequence. River buffalo kappa-casein cDNA. Genus and Species. Bubalus arnee bubalis. Origin of the Clone. Ten micrograms of total RNA from mammary tissue of lactating buffalo was reverse-transcribed using an oligo d(T)17 primer and superscript II reverse transcriptase (GIBCO-BRL, Grand Island, NY). The forward primer (5′GTGACAAGGAAAGGTGCAATG3′) was designed from conserved regions, t...

متن کامل

focus on communication in iranian high school language classes: a study of the role of teaching materials in changing the focus onto communication in language classes

چکیده ارتباط در کلاس به عوامل زیادی از جمله معلمان، دانش آموزان، برنامه های درسی و از همه مهم تر، مواد آموزشی وابسته است. در تدریس ارتباطی زبان که تاکید زیادی بر توانش ارتباطی دارد، کتاب درسی به عنوان عامل موثر بر پویایی کلاس محسوب میگردد که درس ها را از طریق فراهم آوردن متن ارتباط کلاسی و هم چنین نوع تمرین زبانی که دانش آموزان در طول فعالیت های کلاسی به آن مشغول اند، کنترل می کند. این حقیقت ک...

15 صفحه اول

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Journal of Dairy Science

سال: 2011

ISSN: 0022-0302

DOI: 10.3168/jds.2010-4086